| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis> | … DNA fragments including U6 promoter‐driven, small hairpin RNA specific for luciferase gene (shluc) 5′‐ggattccaattcagcgggagccacctgatgaagcttgatcgggtggctctcgc‐ tgagttggaatccattttt‐3′, with or without two Zorro LNA binding sites, were ordered from Genscript (NJ, USA) … | Get A Quote |
RNA polymerase III (pol III)-dependent transcripts are involved in many fundamental activities in a cell, such as splicing and protein synthesis. They also regulate cell growth and influence tumor formation. During recent years vector-based systems for expression of short hairpin (sh) RNA under the control of a pol III promoter have been developed as gene-based medicines. Therefore, there is an increasing interest in means to regulate pol III-dependent transcription. Recently, we have developed a novel anti-gene molecule 'Zorro LNA (Locked Nucleic Acid)', which simultaneously hybridizes to both strands of super-coiled DNA and potently inhibits RNA polymerase II-derived transcription. We have now applied... More