| Products/Services Used | Details | Operation |
|---|---|---|
| Synthetic sgRNA and crRNA Service> | … PBRM1-KO HEK293T cells were generated using guide RNA with CAS9 construct purchased from GenScript. Guide RNA sequence (GAAACCACTTCATAATAGTC) was designed on exon 4. Cells were transfected with CAS9 construct for 48 hours followed by puromycin … | Get A Quote |
Epigenetic effectors "read" marks "written" on chromatin to regulate function and fidelity of the genome. Here, we show that this coordinated read-write activity of the epigenetic machinery extends to the cytoskeleton, with PBRM1 in the PBAF chromatin remodeling complex reading microtubule methyl marks written by the SETD2 histone methyltransferase. PBRM1 binds SETD2 methyl marks via BAH domains, recruiting PBAF components to the mitotic spindle. This read-write activity was required for normal mitosis: Loss of SETD2 methylation or pathogenic BAH domain mutations disrupt PBRM1 microtubule binding and PBAF recruitment and cause genomic instability. These data reveal PBRM1 functions beyond chromatin remodeling wi... More