| Products/Services Used | Details | Operation |
|---|---|---|
| Synthetic sgRNA and crRNA Service> | … CAAGGGCTGCATGACTGGCT, crRNA-2#: TGCTGGGGCCTTCCTCGAGG; DNA templates for gRNA were synthesized and cloned into pGS- gRNA (GenScript, Inc). pSpCas9 (GenScript PX165, 2 µg), pGS-gRNA-1# (1 µg) and gRNA-2# (1 µg) were co … | Get A Quote |
Cytokine-inducible SH2-containing protein (CIS; encoded by the gene CISH) is a key negative regulator of interleukin-15 (IL-15) signaling in natural killer (NK) cells. Here, we develop human CISH-knockout (CISH) NK cells using an induced pluripotent stem cell-derived NK cell (iPSC-NK cell) platform. CISH iPSC-NK cells demonstrate increased IL-15-mediated JAK-STAT signaling activity. Consequently, CISH iPSC-NK cells exhibit improved expansion and increased cytotoxic activity against multiple tumor cell lines when maintained at low cytokine concentrations. CISH iPSC-NK cells display significantly increased in vivo persistence and inhibition of tumor progression in a leukemia xenograft model. Mechanistically, CIS... More