Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | The primer sequences for the WA352 gene (Luo et al. 2013) were synthesized by Genscript (Nanjing, China). Primers include WA352-F (50 ?30 ): GTTGATGGGTATGGATAGAG, WA352-R (50 ? 30 ): CGCAGGGCCTCGGTATATCTA. The total PCR volume was 25 lL, which contained 9.5 lL of a 2 9 PCR mix, 12.5 lL of ddH2O, 1 lL of 10 lmol/L forward primer, 1 lL of 10 lmol/L reverse primers, and 1 lL of the DNA template | Get A Quote |
Weedy rice (Oryza sativa f. spontanea) is a conspecific weedy relative of cultivated Asian rice (O. sativa L.) that occurs in paddy fields worldwide. The mechanism underlying the persistence of weedy rice in rice fields remains unclear. We tested for evidence that southern Chinese weedy rice has originated through pollen flow from weedy rice that has resulted in hybridization with three-line hybrid rice cultivars, which have been extensively cultivated in southern China for the last 40 yr and now account for over half the total rice cultivation in China. To test the hypothesis, we screened for the presence of the maternally inherited WA352 gene in weedy rice populations in southern China. WA352 is a mitochondri... More