Products/Services Used | Details | Operation |
---|---|---|
Custom Vector Construction> | … DNA oligonucleotides designed to express short hairpin RNA (shRNA) specific for human c-FLIP (5′-GATCCGAAAGAGGTAAGCTGTCTGTCTTCAAGAGAGACAGACAGCTTACCTCTTTCT TTTTTGGAAA-3′) were inserted into the pRNAT-U6.1/Neo vector (GenScript, USA) … | Get A Quote |
Cellular FLICE-like inhibitory protein (c-FLIP-L), similar in structure to caspase-8, is capable of blocking Fas- or other death receptors (DR)-mediated apoptosis through association with FADD in the DISC. Recent studies have implicated the function of c-FLIP-L in T-cell proliferation, but the exact mechanism underlying this process remains to be elucidated. In this report, we showed for the first time that c-FLIP-L was present in both the cytoplasm and nucleus of cells, but was more abundantly distributed in the nucleus. The putative NLS signal locates within the p12 region of caspase-like domain. Furthermore, c-FLIP's export to cytoplasm membrane was dependent on apoptotic stimulation, while it ... More