| Products/Services Used | Details | Operation |
|---|---|---|
| PCR Cloning and Subcloning> | ...A synthetic gene (GenScript - New Jersey, USA) was cloned in a pET-SUMO vector. For cloning into the pCRE vector, the gene was amplified via PCR with 0.2 μM forward primer GACTCGAGATCTGCTGCTGGTATGGCACCGTCTG … | Get A Quote |
Regio- and stereoselective Baeyer-Villiger oxidations are difficult to achieve by classical chemical means, particularly when large, functionalized molecules are to be converted. Biocatalysis using flavin-containing Baeyer-Villiger monooxygenases (BVMOs) is a well-established tool to address these challenges, but known BVMOs have shortcomings in either stability or substrate selectivity. We characterized a novel BVMO from the thermophilic fungus Thermothelomyces thermophila, determined its three-dimensional structure, and demonstrated its use as a promising biocatalyst. This fungal enzyme displays excellent enantioselectivity, acts on various ketones, and is particularly active on polycyclic molecules. Most not... More