| Products/Services Used | Details | Operation |
|---|---|---|
| Peptide Synthesis> | The following DNA sequences were purchased from Integrated DNA Technologies. 90nt-ssDNA (5′-CGGGTGTCGGGGCTGGCTTAACTATGCGGCATCAGA GCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGT-3′) and 32nt-dsDNA forward, (5′ –ATATGCGGTGTGAAATACCGCACAGATGCGT-3′) reverse (5′-ACGCATCTGTGCGGTATTTCACACCGCATATG-3′_Cy5). Underlined the homologous region in the 90nt-ssDNA. Synthetic GRB2 PIP motif peptide GASHGQTGMFPRNYVT was purchased from GenScript. | Get A Quote |
Growth factor receptor-bound protein 2 (GRB2) is a cytoplasmic adapter for tyrosine kinase signaling and a nuclear adapter for homology-directed-DNA repair. Here we find nuclear GRB2 protects DNA at stalled replication forks from MRE11-mediated degradation in the BRCA2 replication fork protection axis. Mechanistically, GRB2 binds and inhibits RAD51 ATPase activity to stabilize RAD51 on stalled replication forks. In GRB2-depleted cells, PARP inhibitor (PARPi) treatment releases DNA fragments from stalled forks into the cytoplasm that activate the cGAS-STING pathway to trigger pro-inflammatory cytokine production. Moreover in a syngeneic mouse metastatic ovarian cancer model, GRB2 depletion in the context of PARP... More