Products/Services Used | Details | Operation |
---|---|---|
Synthetic sgRNA and crRNA Service> | A stable knockout of mouse CD137L in the RAW264.7 cell line was done with CRISPR/Cas9 with the gRNA sequence TCTGAGGAGCGCCGCATCCG cloned into the eSpCas9-2A-GFP plasmid (GenScript, Piscataway, NJ, USA) | Get A Quote |
CD137 is a costimulatory molecule expressed on activated T cells. CD137 ligand (CD137L) is expressed by antigen presenting cells (APC), which use the CD137-CD137L system to enhance immune responses. It was, therefore, surprising to discover CD137 expression on regulatory T cells (Treg). The function of CD137 in Treg are controversial. While some studies report that CD137 signalling converts Treg to effector T cells (Teff), other studies find that CD137-expressing Treg display a stronger inhibitory activity than CD137 Treg. Here, we describe that CD137 on Treg binds to CD137L on APC, upon which one of the two molecules is transferred via trogocytosis to the other cell, where CD137-CD137L forms a complex that is ... More