| Products/Services Used | Details | Operation |
|---|---|---|
| Molecular Biology Reagents> | … GACATGACATGCTGGCCTGCG‐3′) and control shRNA (5′‐TGGCATTGTCTTACCGCCTAT‐ 3′), or PTPN22‐shRNA (5′‐GUACGGACACCUGAAUCAUdTdT‐3′) and its respective control shRNA (5′‐TGGCATTGTCTTACCGCCTAT‐3′) (GenScript, Piscataway, NJ, USA … | Get A Quote |
The PTPN22 gene encoding the Lyp/Pep protein tyrosine phosphatase is a negative regulator of T-cell receptor (TCR) signaling. Recent studies have shown that phosphorylation of end-binding protein 1 (EB1) is associated with the TCR activation. In this study, using 2-hybrid and mass spectrometry analyses, we identified EB1 as a protein associated with PTPN22. Furthermore, we discovered that EB1 specifically bound to the P1 domain of PTPN22 by competing with CSK, and the variant PTPN22-R620W does not affect the association with EB1, which is instrumental with respect to the regulation of TCR signaling. In addition, PTPN22 dephosphorylates EB1 at tyrosine-247 (Y247), which decreases the expression of the T-cell act... More