| Products/Services Used | Details | Operation |
|---|---|---|
| DNA Sequencing> | … PCR primer targeting the 16S rDNA gene of pathogenic and nonpathogenic bacteria [19]: Forward primer = 5′- AGAGTTTGATCCTGGCTCAG -3′; reverse primer = 5′- TACGGCTACCTTG TTACGACT -3′. The amplicons were sequenced (Genscript, Nanjing, China) and the … | Get A Quote |
Somatic cell count (SCC) in milk is widely used in the dairy industry, as an indicator of the health of mammary gland. While the SCC of dairy cattle was higher in late lactation than in peak lactation, its association with gene expressions of mammary gland were largely unknown. In this study, a transcriptomic sequencing approach and bioinformatics analysis were used to investigate the differential expressed genes (DEGs) associated with inflammation and immunity between peak and late periods of lactation in Chinese Holstein. A total of 446 DEGs (padj < 0.05 and fold change >2) were identified, 50 of which belonged to seven pathways and five terms related to inflammation and immunity. Our data suggested that the ... More