| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis> | … GGATCCTAATACGACTCACTATAGGA3′ was added in front of the forward and reverse PCR primers as required for subsequent dsRNA synthesis (Table 1) Primers were chosen based on the results of GeneScripts primer design software (https://wwwgenscriptcom/tools/pcr … | Get A Quote |
Voltage-gated sodium channels (VGSC) are transmembrane proteins that generate an action potential in excitable cells and play an essential role in neuronal signaling. Since VGSCs play a crucial role in nerve transmission they have become primary targets for a broad range of commercial insecticides. RNA interference (RNAi) is a valuable reverse genetics tool used in functional genomics, but recently, it has also shown promise as a novel agent that could be used to control agricultural insect pests. In this study, we targeted the VGSC (MpNav) gene in the peach-potato aphid Myzus persicae, by oral feeding of artificial diets mixed with dsRNAs. Knock-down of MpNav gene expression caused up to 65% mortality in 3rd i... More