| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis> | The Platynereis receptor was PCR-amp l ified from larva l cDNA by us ing the pr imers 5′ -ACAATAAAGCTTGCCACCATGATGGAAGTAAGCTATTCAAATGGAAATG ( inc lud ing H indI I I s ite and Kozak consensus) and 5 ′-ACAATAGCGGCC- GCTTAAATATTTGTAGTTTTAGTCGTGTGATCG ( inc lud ing Not I s ite) , and the Capitella receptor clone used was a synthetic construct (GenScript). | Get A Quote |
Life-cycle transitions connecting larval and juvenile stages in metazoans are orchestrated by neuroendocrine signals including neuropeptides and hormones. In marine invertebrate life cycles, which often consist of planktonic larval and benthic adult stages, settlement of the free-swimming larva to the sea floor in response to environmental cues is a key life cycle transition. Settlement is regulated by a specialized sensory-neurosecretory system, the larval apical organ. The neuroendocrine mechanisms through which the apical organ transduces environmental cues into behavioral responses during settlement are not yet understood. Here we show that myoinhibitory peptide (MIP)/allatostatin-B, a pleiotropic neuropept... More