Products/Services Used | Details | Operation |
---|---|---|
Molecular Biology Reagents> | Cell transfection. miR‑490‑3p mimic (5'‑CAACCUGGAGGA CUCCAUGCUG‑3'), inhibitor (5'‑CAGCAUGGAGUCCUC CAGGUUG‑3') and negative control miRNA (NC‑miRNA; 5'‑ACCGCUAAUCAUACGAAUACAC‑3') were purchased from Guangzhou RiboBio Co., Ltd. HMGA2 overexpression vector based on pcDNA3.1 and NC plasmid (pcDNA3.1) was purchased from GenScript Co., Ltd. (Nanjing, China). | Get A Quote |
Glioma is one of the most common types of malignant cancer and the significance of microRNAs (miRNAs) in cancer therapy has been demonstrated. In the current study, miR-490-3p expression was significantly downregulated in glioma tissue and cell lines. Overexpression of miR-490-3p inhibited glioma cell proliferation and migration . In addition, the high-mobility group AT-hook 2 (HMGA2) was identified as a candidate target gene of miR-490-3p. The current study demonstrated that miR-490-3p mimic could inhibit HMGA2 protein expression in glioma cells. In addition, correlation analysis demonstrated that miR-490-3p and HMGA2 expression was inversely correlated in glioma tissues. Furthermore, the inhibitory ef... More