| Products/Services Used | Details | Operation |
|---|---|---|
| Plasmid DNA Preparation> | … Stable knockouts of mouse CD137L were generated in the RAW264.7 cell line by CRISPR/Cas9 with the gRNA sequence TCTGAGGAGCGCCGCATCCG cloned into the eSpCas9‐2A‐GFP plasmid (GenScript, Piscataway, NJ) … | Get A Quote |
Intracellular pathogens are subject to elimination by a cellular immune response, and were therefore under evolutionary pressure to develop mechanisms that allow them to inhibit especially this arm of immunity. CD137, a T cell costimulatory molecule, and its ligand, CD137 ligand (CD137L), which is expressed on antigen presenting cells (APC), are potent drivers of cellular cytotoxic immune responses. Here, we report that different viruses usurp a negative feedback mechanism for the CD137-CD137L system that weakens cellular immune responses. Latent membrane protein (LMP)-1 and Tax, oncogenes of Epstein-Barr virus (EBV), and human T-cell lymphotropic virus (HTLV)-1, respectively, induce the e... More