| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis> | The three tandem M2e sequences 117 (Fig.1A) (H1-H5-H7 or H1-H7-H5) were synthesized by Genscript (Genscript Corp., 118 Nanjing, China), and amplified by polymerase chain reaction with addition of 119 homogenous sequences (5′ end, CCCTCAATGGTACTGGGCCC | Get A Quote |
Influenza is a zoonotic disease that poses severe threats to public health and the 26 global economy. Re-emerging influenza pandemics highlight the demand for 27 universal influenza vaccines. We developed a novel virus platform, AdC68-F3M2e, by 28 introducing three conserved M2e epitopes into the HI loop of the chimpanzee 29 adenovirus (AdV) fiber protein. The M2e epitopes were expressed sufficiently on the 30 AdV virion surface without affecting fiber trimerization. Additionally, one 31 recombinant adenovirus, AdC68-F3M2e(H1-H5-H7), induced robust M2e-specific 32 antibody responses in BALB/c mice after two sequential vaccinations and conferred 33 efficient protection against homologous and heterologous IV chal... More