| Products/Services Used | Details | Operation |
|---|---|---|
| Custom Vector Construction> | ...The guide RNA sequence (CCCCGAGAACCAGTTCAGAG) targeting human GNAS was cloned into an pLentiCRISPR (v2) by GenScript. pGloSensor-22F cAMP plasmids... | Get A Quote |
Despite the wealth of genetic information available, mechanisms underlying pathological effects of disease-associated mutations in components of G protein-coupled receptor (GPCR) signaling cascades remain elusive. In this study, we developed a scalable approach for the functional analysis of clinical variants in GPCR pathways along with a complete analytical framework. We applied the strategy to evaluate an extensive set of dystonia-causing mutations in G protein Gαolf. Our quantitative analysis revealed diverse mechanisms by which pathogenic variants disrupt GPCR signaling, leading to a mechanism-based classification of dystonia. In light of significant clinical heterogeneity, the mechanistic analysis of indi... More