| Products/Services Used | Details | Operation |
|---|---|---|
| Codon Optimization> | Full-length CAAD and Csx1 of Thermoanaerobaculum aquaticum ( NCBI reference sequence: JMFG01000000) were synthe- sized and codon-optimized for expression in Esc heric hia coli by Genscript. Full-length CAAD and Csx1 of Thermoanaerobaculum aquaticum (NCBI reference sequence: JMFG01000000) were synthesized and codon-optimized for expression in Escherichia coli by Genscript. 5′ FAM-labeled single-stranded RNA (ssRNA) oligonucleotides were purchased from GenScript (AGAUAGAUGUAAUUCCGGUGUAGA and CCCAAAAAGCUAAUACAGUAAACC). | Get A Quote |
| Custom DNA/RNA Oligos> | Get A Quote |
Type III CRISPR-Cas (Clustered Regularly Interspaced Short Palindromic Repeats and CRISPR-associated proteins) systems confer antiviral immunity via cyclic oligoadenylate (cOA) signaling. Here, we elucidate a cooperative bacterial defense strategy involving two cOA-activated CRISPR-associated Rossmann fold (CARF)-containing effectors, adenosine deaminase CAAD and ribonuclease Csx1, in Thermoanaerobaculum aquaticum. Genomic analyses indicate widespread co-occurrence of CRISPR-associated adenosine deaminase (CAAD) with ancillary CARF-containing effectors in type III CRISPR systems, suggesting that multiple CARF-containing proteins may contribute to a coordinated cOA-dependent defense. Biochemical and structural s... More