| Products/Services Used | Details | Operation |
|---|---|---|
| Custom Vector Construction> | Full-length SV40 LTag (accession number: P03070) N-terminally double 6× histidine-tagged, together with the TEV cleavage site sequence, was cloned into a pFastBac1 plasmid by GenScript. TAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTG-3′), EP (top 5′-CACTACTTCTGGAATAGCTCAGAGGCCGAGGCG-3′ and bottom 5′-CGCCTCGGCCTCTGAGCTATT CCAGAAGTAGTG-3′) and AT-rich (top 5′-GGCCTCGGCCTCTGCAT AAATAAAAAAAATTA-3′ and bottom 5′-TAATTTTTTTTATTTATGCAGAGGCCGAGGCC-3′) half-origin DNA substrates were synthesized by GenScript (Piscataway) and each annealed by heating at 95 °C for 2 min followed by gentle cooling at −1 °C min−1 to 25 °C. | Get A Quote |
Hexameric helicases are nucleotide-driven molecular machines that unwind DNA to initiate replication across all domains of life. Despite decades of intensive study, several critical aspects of their function remain unresolved1: the site and mechanism of DNA strand separation, the mechanics of unwinding propagation, and the dynamic relationship between nucleotide hydrolysis and DNA movement. Here, using cryo-electron microscopy (cryo-EM), we show that the simian virus 40 large tumour antigen (LTag) helicase assembles in the form of head-to-head hexamers at replication origins, melting DNA at two symmetrically positioned sites to establish bidirectional replication forks. Through continuous heterogeneity analysis... More