| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis> | The coding sequences of Phi29 and SS_01 DNA polymerase were codon-optimized for E. coli expression, synthesized and cloned into the Pet30a plasmids by Genscript Biotechnology (Nanjing, China). Gels were stained using an eStain L1 system (L00657C, Genscript, Nanjing, China). The single-stranded DNA template (200 bp, AGGTCGCCAGTGAAGTCTTTCGGG CTTCCTCTTAATCTTTTTGATGCAATCCGCTTTGCTTCTGACTATAATAGTCAGGGTAA AGACCTGATTTTTGATTTATGGTCATTCTCGTTTTCTGAACTGTTTAAAGCATTTGAGG GGGATTCAATGAATATTTATACCGATTCCGCAGTATTGCACTCTATCGTCGCCAGCCC) and a primer (CTGGCGACCTGGGCTGGCGAC)weresynthesizedbyGenscript Biotechnology (Nanjing, China). Before use, Seq99A synthesized by Genscript (Nanjing, China) washeated in ametal bathat 95 ◦Cfor5minandthenreturnedtoroomtemperature for 30 min. | Get A Quote |
| Plasmid DNA Preparation> | Get A Quote | |
| Protein Electrophoresis and Western> | Get A Quote | |
| CRISPR KI Templates> | Get A Quote |
Isothermal titration calorimetry (ITC) provides direct insight into the energetics of DNA polymerase function, including binding, catalysis, and exonuclease activity. We characterized a Phi29 mutant polymerase (SS_01) engineered to incorporate non-natural nucleotides in the presence of Mg2+, a function absent in the wild-type enzyme. ITC analyses revealed that SS_01 binding to the primed template was strongly influenced by metal ions. In the presence of Mg2+, the polymerase displayed tight binding (KD = 243 nM) and a clear exothermic signal, indicating activation of a large fraction of catalytically competent molecules. By contrast, in the presence of Ca2+, binding produced weaker exothermic signals (KD = 317 n... More