| Products/Services Used | Details | Operation |
|---|---|---|
| PCR Cloning and Subcloning> | FAR4 shRNA (GATCTGGGTGGTGGCCTTCACATTTTCAAGAGAAATGTGAAGGCCACCACCCATTTTT) and Il33 shRNA (GATCCCTGGTTCTAAACAAATGATCAAGAGTCATTTGTTTAGAACCAGGTTTTT) sequences were cloned into the pLVX-shRNA2 lentiviral vector (gene synthesis and subcloning were performed by GenScript Bioech Corporation). | Get A Quote |
Background: Inflammatory bowel disease (IBD) has complex genetic and environmental aspects, and free fatty acid receptors (FFARs) may bridge genetic and dietary aspects. FFAR4 is highly expressed in the intestine and acts primarily as the receptor of long-chain fatty acids, which are major components of the human diet. It is unclear what role, if any, FFAR4 may play in IBD. Methods: Mouse and human colitis samples, mice with complete FFAR4 knockout, intestine-specific FFAR4 knockout and FFAR4 overexpression and cell culture were used. RNA-sequencing analysis and flow cytometry were performed to examine the mechanisms. Findings: The results showed that FFAR4 expression was upregulated in colitis tissues an... More