| Products/Services Used | Details | Operation |
|---|---|---|
| Oligo pool> | Oligonucleotides DNA oligonucleotide library, see Table S5 CustomArray, this Study N/A DNA oligonucleotides used]–AGATCGGAAGAGCGGTTCAG–3 ) were ordered from CustomArray, Inc. as part of a 90,000 oligo pool of 130 nt 1.45 ng/mL of the CustomArray oligo pool, 0.2 mM dNTPs, 1 mL of Phire Hot Start II DNA | Get A Quote |