| Products/Services Used | Details | Operation |
|---|---|---|
| DNA Sequencing> | … Lentiviral constructs (pLentiGuide-Puro) for the expression of guide RNA were prepared and verified by sequencing (GenScript Biotech, Piscataway, NJ). gRNA for SDC-1: 5’ GAGACGTGGGAATAGCCGTC 3’ (Fan etáal., 2017); gRNA for Exostosin-1: 5’ … | Get A Quote |
Myeloid-derived suppressor cells (MDSCs) infiltrate cancer tissue, promote tumor growth, and are associated with resistance to cancer therapies. However, there is no practical approach available to distinguish MDSCs from mature counterparts inside tumors. Here, we show that a recently isolated thioaptamer probe (T1) binds to MDSC subsets in colorectal and pancreatic tumors with high specificity. Whole transcriptome and functional analysis revealed that T1-binding cells contain polymorphonuclear (PMN)-MDSCs characterized by several immunosuppression pathways, ROS production, and T cell suppression activity, whereas T1-non-binding PMNs were mature and nonsuppressive. We identified syndecan-1 as the T1-interactin... More