| Products/Services Used | Details | Operation |
|---|---|---|
| Plasmid DNA Preparation> | … miR-133: 5' UUUGGUCCCCUUCAACCAGCUG 3'. miR-208: 5' AUAAGACGAGCAAAAAGCUUGU 3'. miR-499: 5' UUAAGACUUGCAGUGAUGUUU 3'. All constructs were generated by GenScript and were supplied on the pcDNA3.1 plasmid vector backbone … | Get A Quote |
Following heart injury, cardiomyocytes, are lost and are not regenerated. In their place, fibroblasts invade the dead tissue where they generate a scar, which reduces cardiac function. We and others have demonstrated that combinations of specific miRNAs (miR combo) or transcription factors (GMT), delivered by individual lenti-/retro-viruses in vivo, can convert fibroblasts into cardiomyocytes and improve cardiac function. However, the effects are relatively modest due to the low efficiency of delivery of miR combo or GMT. We hypothesized that efficiency would be improved by optimizing delivery. In the first instance, we developed a multicistronic system to express all four miRNAs of miR combo from a single con... More