Products/Services Used | Details | Operation |
---|---|---|
Plasmid DNA Preparation> | … cells were transfected with EphA2 CRISPR Guide RNA 1 plasmid (KO1; target sequence, CTACAATGTGCGCCGCACCG), or EphA2 CRISPR Guide RNA 2 plasmid (KO2; target sequence, AGGCTCCGAGTAGCGCACAC) which were purchased from GenScript and Expression … | Get A Quote |
Recently, we reported on potent EphA2 targeting compounds and demonstrated that dimeric versions of such agents can exhibit remarkably increased agonistic activity in cellular assays compared to the monomers. Here we further characterize the activity of dimeric compounds at the structural, biochemical, and cellular level. In particular, we propose a structural model for the mechanism of receptor activation by dimeric agents and characterize the effect of most potent compounds in inducing EphA2 activation and degradation in a pancreatic cancer cell line. These cellular studies indicate that the pro-migratory effects induced by the receptor can be reversed in EphA2 knockout cells, by treatment with either a dimer... More