Products/Services Used | Details | Operation |
---|---|---|
Plasmid DNA Preparation> | … The gRNA-pSpCas9-BB-2A-GFP-PX458 plasmid was obtained from GenScript (USA): a 20 bp guide RNA (gRNA) complementary to the end of the first exon of the BAFF-R gene (sequence: CCCTTACCCGGTTTCGGCCG, Figure 1A) was designed using a dedicated software … | Get A Quote |
Primary CNS lymphoma (PCNSL) is an aggressive brain tumor. Despite improvements in therapeutic algorithms, long-term survival remains rare, illustrating an urgent need for novel therapeutic targets. BAFF-R is a pro-survival receptor expressed on most malignant B cells, including PCNSL. To date, its role in PCNSL growth remains elusive. Here, we have created a BAFF-R knockout lymphoma cell line (BAFF-R-KO) using CRISPR-Cas9. In serum-starved conditions, BAFF-R-KO cells exhibit decreased viability compared to BAFF-R cells. Combining an orthotopic mouse model of PCNSL with chronic cranial windows and intravital microscopy, we have demonstrated a significant delay in tumor growth in mice inoculated with BAFF-R-KO ... More