Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | Two vectors were prepared by GenScript (Piscataway, NJ) with puromycin resistance genes 136 and the flanking guide RNA (gRNA) sequences TCCGCATACGTTCACGTTCT and AGAA- 137 TTTCCAAGATCGTTGA and transfected into wild-type B16F0 cells using Lipofectamine 138 2000 (Thermo Fisher Scientific, Waltham, MA). Transfection was confirmed via microscopy 139 visually using a green fluorescent protein control. Derivatives of the B16F0 cell line were 140 obtained from single clones isolated using puromycin selection and single cell plating. About 141 25% of clones exhibited some level of IL12RB2 knockdown, which was confirmed by flow 142 cytometry. | Get A Quote |
Oncogenesis rewires signaling networks to confer a fitness advantage to malig- 18 nant cells. For instance, the B16F0 melanoma cell model creates a cytokine sink for 19 Interleukin-12 (IL-12) to deprive neighboring cells of this important anti-tumor immune 20 signal. While a cytokine sink provides an indirect fitness advantage, does IL-12 provide 21 an intrinsic advantage to B16F0 cells? Functionally, stimulation with IL-12 enhanced 22 B16F0 cell survival but not normal Melan-A melanocytes that were challenged with 23 a cytotoxic agent. To identify a mechanism, we assayed the phosphorylation of pro- 24 teins involved in canonical IL-12 signaling, STAT4, and cell survival, Akt. In contrast 25 to T cells that exh... More