| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis | Reactions were prepared using 2.5mM of each primer, 7.5μL of water, 12.5μL of MasterMix SYBR® Green (LifeTechnologies®, Brazil), and 3μL of purified cDNA. Plasmids containing genes of interest were constructed from commercially-synthesized inserts (GenScript, USA) to serve as positive controls. In addition, partial fragments of LTR-U5, Gag, and envelope from REV-positive samples were amplified and sequenced by Sanger method using previously described primers (Singh et al. 2003; Barbosa et al. 2007; Li et al. 2013). For the envelope region, an additional primer was designed (gp90-7242R 5’–GCCAGTATGCACAGCCCTATCCA–3’). | Get A Quote |
Reticuloendotheliosis retroviruses (REV) are known to cause immunosuppressive and oncogenic disease that affects numerous avian species. REV is present worldwide and recently has been reported in South America with cases of infected commercial flocks in Argentina. We surveyed for the presence of REV in birds from a state in the northern region of Brazil using real-time PCR. We report the first cases of REV in Brazil, detected in Muscovy ducks (Cairina moschata), wild turkeys (Meleagris gallopavo), and chickens (Gallus gallus) at a relatively high prevalence rate (16,8%). Phylogenetic analysis indicated a close relationship of this strain to variants in the United States. This study provides evidence of REV in t... More
