| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis> | The 16S rRNA gene was amplified by the universal primers 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (ACGGCTACCTTGTTACGACTT) on a T100 Thermocycler (BioRad, USA).20 The polymerase chain reaction (PCR) mixtures consisted of 12.5 μL of 2 × Mix (Yifeixue Biotechnology, Nanjing, China), 1.5 μL of primer pair (10 μM), 10 μL of PCR degrade water and 1 μL of DNA template. The PCR programs for 16S rRNA amplification were: 5 min at 94 °C for pre-denaturation, 35 s at 94 °C for denaturation, 30 s at 55 °C for annealing and 1.5 min at 72 °C for extension (35 cycles), and 10 min at 72 °C for a final extension.20 The PCR products were purified and sequenced by GenScript Co., Ltd. (Nanjing, China). Based on the sequence analysis by BLAST similarity search in the NCBI database, the phylogenetic tree was constructed by using the neighbor-joining algorithm in the MEGA 5.0 program. | Get A Quote |
In the last few decades, bacteria capable of bacterial cellulose (BC) synthesis and the characterization of BC have been well-documented. In this study, a new BC-producing bacterial strain was isolated from fermented vinegar. The BC morphology, composition and diameter distribution, and the genes associated with BC production were analyzed. The results showed that one out of five isolates belonging to Komagataeibacter was a BC-producer, which mostly produced the typical cellulose I consisting of nanofibrils and had several functional groups similar to typing paper (i.e., plant cellulose). Several known genes such as glk, pgm and UPG2 in glucose metabolisms, bcsA, bcsB, bcsC and bcsD in BC synthesis... More