| Products/Services Used | Details | Operation |
|---|---|---|
| Peptide Synthesis> | Peptides containing 20 PR dipeptide repeats and a C-terminal HA epitope tag were synthesized at Genscript. Hydroxyurea (H8627), heparin sodium salt (H3149) and salmon PROTAMINE (P4005) were obtained from Sigma, cycloheximide (239764) from Calbiochem and lactimidomycin (56295) from EMD Millipore. Fluorophore-labelled oligonucleotides were synthesized by Sigma, with the following sequences: Cy3-5’-DNA (CCACTGCACCGCTGCTAGG); Cy5-5’-DNA (CCTAGCAGCGGTTGCAGTGG); Cy3-5’- RNA (CCACUGCACCGCUGCUAGG) and Cy5-RNA (CCUAGCAGCGGUUGCAGUGG). | Get A Quote |
Expanded intronic GGGGCC sequences in C9ORF72 found in patients of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are translated into several dipeptide-repeat polypeptides (DPRs), from which the two that contain arginine, (PR)n and (GR)n, accumulate at nucleoli and kill cells. While this toxicity plays an important role in ALS/FTD, its mechanism remains unknown. We here show that (PR)n polypeptides bind DNA and RNA, so that any reaction involving nucleic acids is impaired by the DPRs. Consistently, (PR)n-induced cell death is rescued by addition of non-coding oligonucleotides. Interestingly, the effects of (PR)n are mimicked by protamine, a sperm-specific arginine-rich protein with affi... More