Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | gRNA-encoding plasmids were constructed upon the lentiGuide-Puro (Addgene Plasmid #52963) vector, in which the puromycin resistant element was swapped to sequence that encodes vexGFP, mCherry or Thy1.1. The scramble control sequence or the sequence targeting CD4421 were subsequently cloned into the vexGFP vector. The design of the guide RNA sequences targeting CD40, and the CRISPRv2 constructs encoding the relevant gRNAs were obtained from Genscript (https://www.genscript.com/CRISPR-plasmid-gRNA-cas9.html?src=pullmenu3). The CD40 gRNA sequences are as follows: SgCD40.1, AGCGAATCTCCCTGTTCCAC; SgCD40.2, GACAAACAGTACCTCCACGA; SgCD40.3, ACGTAACACACTGCCCTAGA | Get A Quote |
Inflammatory bowel diseases (IBD) are complex, multifactorial disorders characterized by chronic relapsing intestinal inflammation. Association studies have identified hundreds of genes that are linked to IBD and potentially regulate its pathology. The further dissection of the genetic network underlining IBD pathogenesis and pathophysiology is hindered by the limited capacity to investigate the role of each GWAS association through functional studies, including the generation of knockout animal models for each of the associated genes. The CRISPR/Cas9 system represents a cutting edge technology which has the potential to transform the field of IBD research by facilitating the introduction of genetic alterations... More