Products/Services Used | Details | Operation |
---|---|---|
Custom Vector Construction> | Briefly, znf16l with adapter sequences were amplified with the following primers: 5’- GTGGCCGCAGAACGAGTGGACCGGCCGCCACCATGAGCCGAAAAAGGAA-3’ and 5’- CATGTCTGGATCATCATCGATTttacccagtttgcaccttgtc-3’ and cloned into the sox10- promoter vector with CloneEZ® PCR-Cloning kit (GenScript). | Get A Quote |
Precise control of oligodendrocyte migration and development is crucial for myelination of axons in the central nervous system (CNS), but important questions remain unanswered about the mechanisms controlling these processes. In a zebrafish screen for myelination mutants, we identified a mutation in zinc finger protein 16-like (znf16l). znf16l mutant larvae have reduced myelin basic protein (mbp) expression and reduced CNS myelin. Marker, time-lapse and ultrastructural studies indicated that oligodendrocyte specification, migration and myelination are disrupted in znf16l mutants. Transgenic studies indicated that znf16l acts autonomously in oligodendrocytes. Expression of Zfp488 from mouse rescued mbp expressio... More