Products/Services Used | Details | Operation |
---|---|---|
Transient Expression> | … 22 PLK3‐deficient A375 derivatives A construct for a guide RNA targeting PLK3 (GACAGGAAACCGGCGGCAGG) was supplied by GenScript Biotech Corp in pLentiCRISPRv2 vector, which also expresses Cas925 This construct was transiently transfected into A375 cell … | Get A Quote |
The activation of oncogenic mitogen-activated protein kinase cascade via mutations in BRAF is often observed in human melanomas. Targeted inhibitors of BRAF (BRAFi), alone or as a part of a combination therapy, offer a significant benefit to such patients. Unfortunately, some cases are initially nonresponsive to these drugs, while others become refractory in the course of treatment, underscoring the need to understand and mitigate the underlying resistance mechanisms. We report that interference with polo-like kinase 3 (PLK3) reduces the tolerance of BRAF-mutant melanoma cells to BRAFi, while increased PLK3 expression has the opposite effect. Accordingly, PLK3 expression correlates with tolerance to BRAFi in a ... More