| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis> | Stable si-RNA expression cell lines For generation of small interfering RNA (siRNA) stable expression cell lines, HCT116 cells were transfected in 6-cm diameter dishes with 5 μg of pRNAT-U6- siAHR (5′-GGATCCCAAGATGGATCAATACTTCCACTTGATATCCGGTGGAAGTATTGATCCA TCTTTTTTTTCCAAAAGCTT-3 ′) or pRNAT-U6-s iScramb le (5 ′-GGATCCCACATGAT CGACTATAACACGT TTGATATCCGGTGGAAGTATTGATCCATCTTTTTTTTCCAAAAGCTT- 3 ′) (Genscript) using Lipofectamine 2000 (Life Technologies) . | Get A Quote |
The polyphenolic flavone chrysin has been evaluated as a natural chemopreventive agent due to its anti-cancer effects in a variety of cancer cell lines. However, the mechanism of the chemopreventive effect has been not well established, especially in human colorectal cancer cells. We evaluated the chemopreventive effect of chrysin in three different human colorectal cancer cell lines. We found that chrysin treatment consequently reduced cell viability via induction of apoptosis. We identified that the involvement of up-regulation of pro-apoptotic cytokines tumor necrosis factor (Tnf) α and β genes and consequent activation of the TNF-mediated transcriptional pathway in chrysin-induced apoptosis. Using our gen... More