| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis | Gene Primer (5’ – 3’) Accession number Reference* crf crf-r1 crf-r2 star p450scc 11β-hyd F – gcc gcg caa agt tca aaa R – gcgaggagaatctgtgcgtaa F – gaa atg cca cct ggt tcg tg R – agc ctg cac cag atc aca tt F – aat ggt gag gtt cgg tct gc R – tgt ggg aat gga cat cgc tc F – ttg aac aag ctc tcc gga cc R – cac tgt atg tct cct cgg ca F – agg gcc atc acc cca ata g R – cca ggc ctt ccc ttc ttt tag F – gct cat gca cat tct gag ga R – tgt gct gaa ggt gat tct cg BC085458 (Alsop and Vijayan, 2008) XM691254 ENSDART 00000055713 NM131663 NM152953 (Alderman and Bernier, 2009) NM001080204 (Ings and Van Der Kraak, 2006) 11β-hsd2 F – cac gac tta ccc tcc tgc aa R – aca agc ccc cac aaa tct ct NM212720 gr mr 18s F – aca gct tct tcc agc ctc ag R – ccg gtg ttc tcc tgt ttg at F – ccc att gag gac caa atc ac R – agt aga gca ttt ggg cgt tg NM001020711 (Alsop and Vijayan, 2008) EF567113 (Alsop and Vijayan, 2008) F – ggc ggc gtt att ccc atg acc R – ggt ggt gcc ctt ccg tca att c FJ915075 β-actin F – tgt ccc tgt atg cct ctg gt R – aag tcc aga cgg agg atg g ubiquitin F – tgt ccc tgt atg cct ctg gt R – aag tcc aga cgg agg atg g AF025305 (Alsop and Vijayan, 2008) BC105746 (Alsop and Vijayan, 2008) * Where no reference is provided, primers were designed for the present study using Primer3 or Primer3Plus, and primer specificity was verified by sequencing (GenScript, Piscataway, NJ, USA). | Get A Quote |
The present study examined the effects of maternal social status, with subordinate status being a chronic stressor, on development and activity of the stress axis in zebrafish embryos and larvae. Female zebrafish were confined in pairs for 48 h to establish dominant/subordinate hierarchies; their offspring were reared to 144 h post-fertilization (hpf) and sampled at five time points over development. No differences were detected in maternal cortisol contribution, which is thought to be an important programmer of offspring phenotype. However, once zebrafish offspring began to synthesize cortisol de novo (48 hpf), larvae of dominant females exhibited significantly lower baseline cortisol levels than offspri... More
