| Products/Services Used | Details | Operation |
|---|---|---|
| Custom Vector Construction> | For constructs expressing cdr2- specific shRNA, the sequences 5′-GGATCCCGTTGATGCAACTAAATATCTCCTTGAT ATCCGGGAGATATTTAGTTGCATCAATTTTTTCCAAAAGCTT-3′ (#1) or 5′-GGATCC CGTTTCGCATGCTGCTCATTCATTTGATATCCGATGAATGAGCAGCATGCGAAATTT TTTCCAAAAGCTT-3′ (#2) were chosen based on recommendations by Genscript’s shRNA design center (http://www....genscript. | Get A Quote |
Cerebellar degeneration-related protein 2 (cdr2) is expressed in the central nervous system, and its ectopic expression in tumor cells of patients with gynecological malignancies elicits immune responses by cdr2-specific autoantibodies and T lymphocytes, leading to neurological symptoms. However, little is known about the regulation and function of cdr2 in neurodegenerative diseases. Because we found that cdr2 is highly expressed in the midbrain, we investigated the role of cdr2 in experimental models of Parkinson's disease (PD). We found that cdr2 levels were significantly reduced after stereotaxic injection of 1-methyl-4-phenylpyridinium (MPP(+)) into the striatum. cdr2 levels were also decreased in the brain... More