| Products/Services Used | Details | Operation |
|---|---|---|
| Plasmid DNA Preparation> | The plasmid encoding the sgRNA targeting Hey1 (TGACGCGCACGCCCTTGCTA) cloned into the pSPCAS9 BB-2A-GFP (PX458) was generated by GenScript.... Generation of SHEP Hey1-KO clones using CRISPR/CAS9 editing SHEP cells were transiently transfected with the plasmid encoding SpCAS9, Hey1-targeted gRNA, and GFP (Genscript, target sequence: GATAACGCGCAACTTCTGCC) using Jet- Prime. | Get A Quote |
The neurotrophin-3 (NT-3) receptor tropomyosin receptor kinase C (TrkC/NTRK3) has been described as a dependence receptor and, as such, triggers apoptosis in the absence of its ligand NT-3. This proapoptotic activity has been proposed to confer a tumor suppressor activity to this classic tyrosine kinase receptor (RTK). By investigating interacting partners that might facilitate TrkC-induced cell death, we have identified the basic helix-loop-helix (bHLH) transcription factor Hey1 and importin-α3 (karyopherin alpha 4 [KPNA4]) as direct interactors of TrkC intracellular domain, and we show that Hey1 is required for TrkC-induced apoptosis. We propose here that the cleaved proapoptotic portion of TrkC intracellula... More