| Products/Services Used | Details | Operation |
|---|---|---|
| Molecular Biology Tools> | siRNA selection tool siRNA sense strand siDesign centre (Dharmacon) GCACACAACAGCAGCCAAG BiopredSi (Qiagen) CCTCCAAAGCCATTGTAAA Predicted off-target CASP14 SHROOM4 VANGL2 SATB2 IKZF1 SPRED1 WI siRNA selection server (Whitehead institute) GenscriptsiRNA target finder (Genscript) siDirect AATGTGTGTACAGTGTGTATA PAFAH1B1 AAGGTATGGAGCGATGTGACG GTTGTTTTCTAAAAAAAAAAA PCSK2 JOSD1 LTBP4 DISC1 EBF2 GSK3B Related GO Process proteolysis multicellular organismal development multicellular organismal development multicellular organismal development multicellular organismal development multicellular organismal development multicellular organismal development proteolysis proteolysis Regulation of proteolysis multicellular organismal development multicellular organismal development multicellular organismal development with four potent siRNA selection algorithms of present day on a common test set (Huesken et al. | Get A Quote |
Investigations have revealed that silencing unwanted transcripts or off-targeting can induce false positive phenotype during RNA interference (RNAi)-based gene function study. But still the standard computational approaches towards small interfering RNA (siRNA) off-target minimization fall short in terms of addressing this false positive phenotype issue. Some of these off-targets may interfere with the biochemical pathway being investigated. It may also inadvertently target cell's metabolic pathways with unquantifiable consequences on the processes of user's interest. Here, we report the development of a siRNA selection tool that, for the first time, implements a functional off-target filtering that aims to min... More