| Products/Services Used | Details | Operation |
|---|---|---|
| Custom Vector Construction> | RNA inhibition Materials A short hairpin RNA (shRNA) cassette (GenScript, Scotch Plains, NJ) was constructed targeting the NL sequence GGATGTAGTTTCCACCTATGT with the intention of suppressing NL expression....1/Neo (Genscript) that uses a U6 promoter for shRNA expression and carries the GFP marker under control of a CMV promoter to track the transfection. | Get A Quote |
Neuroligins are cell adhesion molecules that interact with neurexins on adjacent cells to promote glutamatergic and GABAergic synapse formation in culture. We show here that neuroligin enhances nicotinic synapses on neurons in culture, increasing synaptic input. When neuroligin is overexpressed in neurons, the extracellular domain induces presynaptic specializations in adjacent cholinergic neurons as visualized by SV2 puncta. The intracellular domain is required to translate the SV2 puncta into synaptic input as reflected by increases in the frequency of spontaneous mini-synaptic currents. The PDZ-binding motif of neuroligin is not needed for these effects. Together, the extracellular and proximal intracellular... More