Products/Services Used | Details | Operation |
---|---|---|
Custom Vector Construction> | Source organism DNA source Forward primer Reverse primer Expression vector Expression host Construct sequence Homo sapiens Synthesized (GenScript) GACGACGACAAGATGGAGAATCTTTATTTTCAGGGCGA- TCAAGTAAAGAAGAGGAAAAAA GAGGAGAAGCCCGGTTAGTTCTTTTCACCAATCACAAT- GG pET-46 Ek/LIC E. | Get A Quote |
A-kinase anchoring proteins (AKAPs) are a family of proteins that provide spatiotemporal resolution of protein kinase A (PKA) phosphorylation. In the myocardium, PKA and AKAP18γ/δ are found in complex with sarcoendoplasmic reticulum Ca(2+)-ATPase 2 (SERCA2) and phospholamban (PLB). This macromolecular complex provides a means by which anchored PKA can dynamically regulate cytoplasmic Ca(2+) release and re-uptake. For this reason, AKAP18γ/δ presents an interesting drug target with therapeutic potential in cardiovascular disease. The crystal structure of the central domain of human AKAP18γ has been determined at the atomic resolution of 1.25 Å. This first structure of human AKAP18γ is trapped in a novel ... More