| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis> | The ATP aptamer (ACCTGGGGGAGTATTGCGGAGGAAGGT), cDNA of ATP aptamer (ACCTTCCTCCG-CAATACTCCCCCAGGT), control aptamer (ACCTGGGGGAGTATTGTAAAAAAGAAT), and cDNA of control aptamer (ATTCTTTTTTACAATACTCCCCCAGGT) were synthesized by Genscript Biotechnology Company (Nanjing, China). D | Get A Quote |
Energy metabolism abnormity is one of the most significant hallmarks of cancer. As a result, large amino acid transporter 1 (LAT1) is remarkably overexpressed in both blood-brain-barrier and glioma tumor cells, leading a rapid and sufficient substrate transportation. 3CDIT and 4CDIT are originally synthesized by modifying the existing most potent LAT1 substrate. 3CDIT is selected as its higher glioma-targeting ability. Since the microenvironment variation in tumor cells is another important feature of cancer, a great disparity in adenosine-5'-triphosphate (ATP) and glutathione (GSH) levels between extracellular and intracellular milieu can provide good possibilities for dual-responsive drug release in tum... More