Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | BB-2A-GFP pX458 (GenScript, China): GGCCACCATTATACAATAGA (EN-domain_01), GCAGTTAAAAAGGCAGGTGT (EN-domain_02) and GTCTTGCCGATCAATATCGC (RQ-domain_01). | Get A Quote |
Targeted cancer therapy is based on exploiting selective dependencies of tumor cells. By leveraging recent functional screening data of cancer cell lines we identify Werner syndrome helicase (WRN) as a novel specific vulnerability of microsatellite instability-high (MSI-H) cancer cells. MSI, caused by defective mismatch repair (MMR), occurs frequently in colorectal, endometrial and gastric cancers. We demonstrate that WRN inactivation selectively impairs the viability of MSI-H but not microsatellite stable (MSS) colorectal and endometrial cancer cell lines. In MSI-H cells, WRN loss results in severe genome integrity defects. ATP-binding deficient variants of WRN fail to rescue the viability phenotype of... More