Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | Biotinylated and unlabeled HBV PRE RNA probe (AUACUGCGGAACUCCUAGCCGCUUGUUUUGCUCGCAGCAGGUCUGGAG CAAACAUU – ntd 1268-1323) were synthesized and HPLC purified by Genscript. | Get A Quote |
A hallmark of chronic hepatitis B (CHB) virus infection is the presence of high circulating levels of non-infectious small lipid HBV surface antigen (HBsAg) vesicles. Although rare, sustained HBsAg loss is the idealized endpoint of any CHB therapy. A small molecule, RG7834, has been previously reported to inhibit HBsAg expression by targeting terminal nucleotidyltransferase proteins 4A and 4B (TENT4A and TENT4B). In this study, we describe a genome-wide CRISPR screen to identify other potential host factors required for HBsAg expression and to gain further insights into the mechanism of RG7834. We report more than 60 genes involved in regulating HBsAg and identify additional factors involved in RG7834 activity,... More