| Products/Services Used | Details | Operation |
|---|---|---|
| Insect Expression System > | 030 Continued REAGENT or RESOURCE Rad52 siRNA FANCA targeting CRISPR construct High five insect cells Lipofectamine 2000 SOURCE Dharmacon Genscript Invitrogen Invitrogen CONTACT FOR REAGENT AND RESOURCE SHARING IDENTIFIER L-011760-00-05 Custom construct (see STAR Methods for sequence) B85502 11668019 Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Yanbin Zhang (yzhang4@med.... FANCA CRISPR knockout constructs in Cas9-GFP backbone with a sgRNA sequence of CCAAGGCCATGTCCGACTCG were purchased from Genscript. | Get A Quote |
FANCA is a component of the Fanconi anemia (FA) core complex that activates DNA interstrand crosslink repair by monoubiquitination of FANCD2. Here, we report that purified FANCA protein catalyzes bidirectional single-strand annealing (SA) and strand exchange (SE) at a level comparable to RAD52, while a disease-causing FANCA mutant, F1263Δ, is defective in both activities. FANCG, which directly interacts with FANCA, dramatically stimulates its SA and SE activities. Alternatively, FANCB, which does not directly interact with FANCA, does not stimulate this activity. Importantly, five other patient-derived FANCA mutants also exhibit deficient SA and SE, suggesting that the biochemical activit... More