| Products/Services Used | Details | Operation |
|---|---|---|
| Custom Vector Construction> | 08×104 TCID50/mL) obtained from Bionote heavy chain subunit was genetically cloned into material for the purification of human apoferritin pET-28b(+) vector by standard polymerase chain reaction (PCR) method (see the Figure S2 GGCCCCAAGGGGTTATGCTAGT supportive information) using primer Forward: GATCCCGCGAAATTAATACG (GenScript, Hong and Reverse: AFN gene (FTH1, NM_002032), Protein-G and Kong). | Get A Quote |
Infectious pancreatic necrosis virus (IPNV) has been identified as a viral pathogen for many fish diseases that have become a huge hurdle for the growing fishing industry. Thus, in this work, we report a label-free impedance biosensor to quantify IPNV in real fish samples at point-of-care (POC) level. High specificity IPNV sensor with a detection limit of 2.69 TCID/mL was achieved by conjugating IPNV antibodies to portable Au disk electrode chips using human heavy chain apoferritin (H-AFN) nanoprobes as a binding agent. H-AFN probes were bioengineered through PCR by incorporating pET-28b(+) resulting in 24 subunits of 6 × his-tag and protein-G units on its outer surface to increase the sensitivity of the I... More