| Products/Services Used | Details | Operation |
|---|---|---|
| Custom Vector Construction> | … LDHA knockout using CRISPR/Cas9 system. The sgRNA target sequence ( GGTGTAAGTATAGCCTCCTG) was designed using Genscript software (genscript.com/gRNA- design-tool). sgRNA was cloned into the lentiCRISPR v2 vector (Addgene, Cambridge, MA, USA) … | Get A Quote |
We investigated the intracellular metabolic fluxes of protein kinase CK2-activating (Cα OE) cells and role of lactate dehydrogenase A (LDHA) as a contributor of tumorigenesis after reprogrammed glucose metabolism. Facilitated aerobic glycolysis was confirmed via isotope tracer analysis, in which C-Glc or C-Gln was added to the media, following which metabolites converted from Cα OE cells were identified. We found a greater decrease in cell survival, colony-forming ability, migration, and Cα OE cell invasion under glucose (Glc)-depletion conditions than under glutamine (Gln)-depletion conditions. Cancer cell migration and invasion increased due to LDHA elevation of the altered metabolic axis driven ... More