| Products/Services Used | Details | Operation |
|---|---|---|
| Custom Vector Construction> | Psgl-1 (SELPLG, NM_003006.4) gRNA CCTGCTGCAAGGCGTTCTAC was synthesized in the vector pSpCas9(BB)-2A-GFP (PX458) by GenScript (NJ, USA) | Get A Quote |
Methicillin resistant Staphylococcus aureus?(MRSA) is a major human pathogen, which causes superficial to lethal clinical infections. Neutrophils are the most abundant leukocytes in the blood and are the first defense mechanism against S. aureus infections. Here we show Staphylococcal Superantigen-Like protein 11 (SSL11) from MRSA USA300_FPR3757 mediated differentiated human neutrophil-like cells (dHL60) motility arrest by inducing cell adhesion and "locking" cells in adhesion stage, without inducing oxidative burst. Pre-incubation of SSL11 with the glycan Sialyl Lewis X blocked SSL11 function and de-glycosylation of dHL60 cells by PNGase F abolished SSL11 binding, suggesting that SSL11 functions via inte... More