Products/Services Used | Details | Operation |
---|---|---|
Gene Synthesis> | … following primers: 5 - CGGAATTCATGCTGCGCTACCTGCTTAAAAC- 3 and 5 - TTGGCGCGCCAATGAAGGGTCATC TTGGTTCCTC-3 . The CDS of Robo3.1 with mu- tated m6A sites (MTm6A: A1505C, A2071T, A2149T, A2199C, A3797C) was synthesized by Genscript … | Get A Quote |
N 6-Methyladenosine (m6A) is a dynamic mRNA modification which regulates protein expression in various posttranscriptional levels. Functional studies of m6A in nervous system have focused on its writers and erasers so far, whether and how m6A readers mediate m6A functions through recognizing and binding their target mRNA remains poorly understood. Here, we find that the expression of axon guidance receptor Robo3.1 which plays important roles in midline crossing of spinal commissural axons is regulated precisely at translational level. The m6A reader YTHDF1 binds to and positively regulates translation of m6A-modified Robo3.1 mRNA. Either mutation of m6A sites in Robo3.1 mRNA or YTHDF1 knockdown or knockout ... More