| Products/Services Used | Details | Operation |
|---|---|---|
| Custom Vector Construction> | A 2 kb PINCR promoter region (chrX: 43,034,255–43,036,255) with (WT-p53RE) and without (Dp53RE) the 20 bp p53RE (GCCCTTGTCTGGACATGCCC) was synthesized in pGL3 luciferase vector by GenScript. | Get A Quote |
Thousands of long noncoding RNAs (lncRNAs) have been discovered, yet the function of the vast majority remains unclear. Here, we show that a p53-regulated lncRNA which we named PINCR (p53-induced noncoding RNA), is induced ~100-fold after DNA damage and exerts a prosurvival function in human colorectal cancer cells (CRC) in vitro and tumor growth in vivo. Targeted deletion of PINCR in CRC cells significantly impaired G1 arrest and induced hypersensitivity to chemotherapeutic drugs. PINCR regulates the induction of a subset of p53 targets involved in G1 arrest and apoptosis, including BTG2, RRM2B and GPX1. Using a novel RNA pulldown approach that utilized endogenous S1-tagged PINCR, we show that PINCR associates... More