| Products/Services Used | Details | Operation |
|---|---|---|
| Gene Synthesis> | … Bcl-AR, GTCAGAGCTCTGACGAGCTCTGGTATCGGTGGTAATG, SacI. To compare the functionality of bclB with bclA, the bclA gene (synthesized by GenScript in pUC19 vector between restriction sites NdeI and SacI) was used as a positive control in the present study … | Get A Quote |
Biodesulfurization is an eco-friendly process for removing sulfur from petroleum fractions. The process could not be commercialized because of the inability of microorganisms to desulfurize a wide range of heterocyclic poly aromatic sulfur compounds like dibenzothiophene (DBT), 4, 6-Dimethyl DBT present in fuel and low desulfurization activity. In the present study, to improve the rates of conversion of dibenzothiophene to dibenzothiophene sulfone, the responsible enzyme dibenzothiophene monooxygenase DszC, is displayed on the surface of Escherichia coli. This helped in overcoming the mass transfer limitation and resulted in approximately 3 times faster conversion with respect to control (which contai... More