| Products/Services Used | Details | Operation |
|---|---|---|
| Codon Optimization> | ... and GGGGATCCAAAGATAGAGGAGCAGATC for His-tagged enzyme, and sequences ATAAGGAGGAGGGCATATGGCTGA and GGGGATCCAAAGATAGAGGAGCAGATC for non-tagged enzyme), or synthesized as E. coli codon optimized versions (GenScript, Piscataway, ... | Get A Quote |
With the aim of identifying novel thermostable esterases, comprehensive sequence databases and cloned fosmid libraries of metagenomes derived from an offshore oil reservoir on the Norwegian Continental Shelf were screened for enzyme candidates using both sequence-and function-based screening. From several candidates identified in both approaches, one enzyme discovered by the functional approach was verified as a novel esterase and subjected to a deeper characterization. The enzyme was successfully over-produced in Escherichia coli and was shown to be thermostable up to 90°C, with the highest esterase activity on short-chain ester substrates and with tolerance to solvents and metal ions. The fact that the therm... More